Review



thermo fisher r78007 recombinant dna reagent resource reference  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher thermo fisher r78007 recombinant dna reagent resource reference
    Thermo Fisher R78007 Recombinant Dna Reagent Resource Reference, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/DNA/pm41044218-255-27-27
    Average 99 stars, based on 1 article reviews
    thermo fisher r78007 recombinant dna reagent resource reference - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Tumor initiating cells induce Cxcr4-mediated infiltration of pro-tumoral macrophages into the brain
    Article Snippet: .. Recombinant DNA reagent , pDEST (Gateway vector) , Invitrogen , , . .. Recombinant DNA reagent , lexOP-AKT1-RFP (plasmid) , this paper , lexOP:AKT1-lexOP:tagRFP , Gateway vector: pDEST.

    Article Title: Neurogliaform cortical interneurons derive from cells in the preoptic area
    Article Snippet: Recombinant DNA reagent , RNAScope Probe-tdTomato-C2 , Affimetrix, Santa Clara, CA , 317041-C2 , . .. Recombinant DNA reagent , RNAScope Probe-EGFP , Affimetrix , 400281 , . .. Recombinant DNA reagent , RNAScope Probe-Car4-C3 , Affimetrix , 468421-C3 , .

    RNAscope:

    Article Title: Neurogliaform cortical interneurons derive from cells in the preoptic area
    Article Snippet: Recombinant DNA reagent , RNAScope Probe-tdTomato-C2 , Affimetrix, Santa Clara, CA , 317041-C2 , . .. Recombinant DNA reagent , RNAScope Probe-EGFP , Affimetrix , 400281 , . .. Recombinant DNA reagent , RNAScope Probe-Car4-C3 , Affimetrix , 468421-C3 , .



    Similar Products

    91
    ATCC ygr127wδ strain recombinant dna reagent prs313 ygr127w
    Ygr127wδ Strain Recombinant Dna Reagent Prs313 Ygr127w, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pRS313/10__7554_slash_elife__105418__3-147-98-131
    Average 91 stars, based on 1 article reviews
    ygr127wδ strain recombinant dna reagent prs313 ygr127w - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    99
    Thermo Fisher thermo fisher r78007 recombinant dna reagent resource reference
    Thermo Fisher R78007 Recombinant Dna Reagent Resource Reference, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/DNA/pm41044218-255-27-27
    Average 99 stars, based on 1 article reviews
    thermo fisher r78007 recombinant dna reagent resource reference - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Merck & Co 2015 recombinant dna n a reagent resource reference
    2015 Recombinant Dna N A Reagent Resource Reference, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/id+reference/pm41501164-178-3-21
    Average 86 stars, based on 1 article reviews
    2015 recombinant dna n a reagent resource reference - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology 214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay
    214488 Recombinant Dna Reagent Lakritz Forward Primer Ccggaattacatcccaagaac Kay, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/Acridine+Orange+hemi(zinc+chloride)+salt/pm41187058-320-49-45
    Average 93 stars, based on 1 article reviews
    214488 recombinant dna reagent lakritz forward primer ccggaattacatcccaagaac kay - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a
    N2xstrep Ires Puro Addgene Rrid Addgene 141391 Recombinant Dna Reagent Pet29a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro+(Plasmid+%23141391)/10__7554_slash_elife__108922-335-51-54
    Average 93 stars, based on 1 article reviews
    n2xstrep ires puro addgene rrid addgene 141391 recombinant dna reagent pet29a - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov
    E2xstrep Ires Puro Addgene Rrid Addgene 141385 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro+(Plasmid+%23141385)/10__7554_slash_elife__108922-335-25-28
    Average 93 stars, based on 1 article reviews
    e2xstrep ires puro addgene rrid addgene 141385 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov
    M2xstrep Ires Puro Addgene Rrid Addgene 141386 Recombinant Dna Reagent Plvx Ef1alpha Sars Cov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pLVX-EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro+(Plasmid+%23141386)/10__7554_slash_elife__108922-335-38-41
    Average 93 stars, based on 1 article reviews
    m2xstrep ires puro addgene rrid addgene 141386 recombinant dna reagent plvx ef1alpha sars cov - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid
    Paav Cag Backbone Recombinant Dna Reagent Paav Cag Ftacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pDONR223-LIMK2+(Plasmid+%2323834)/10__7554_slash_elife__106508__3-245-107-105
    Average 93 stars, based on 1 article reviews
    paav cag backbone recombinant dna reagent paav cag ftacr eyfp plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid
    Pcdna3 1 Backbone Recombinant Dna Reagent Paav Cag Ansacr Eyfp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pLKO%2E1-puro-PARG+shRNA+(Plasmid+%2323260)/10__7554_slash_elife__106508__3-245-93-91
    Average 93 stars, based on 1 article reviews
    pcdna3 1 backbone recombinant dna reagent paav cag ansacr eyfp plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid
    Pcdna3 1 Backbone Recombinant Dna Reagent Nlccr Pcdna3 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/recombinant+dna+reagent/pIRESneo-MPG(N169D)+(Plasmid+%2323259)/10__7554_slash_elife__106508__3-245-82-80
    Average 93 stars, based on 1 article reviews
    pcdna3 1 backbone recombinant dna reagent nlccr pcdna3 1 plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results